Journal:

Article Title: Identification of Novel Retinal Target Genes of Thyroid Hormone in the Human WERI Cells by Expression Microarray Analysis

doi: 10.1016/j.visres.2007.04.023

Figure Lengend Snippet: T3-induced genes in WERI cells (fold-change ≥ 4, p-value ≤0.01)

Article Snippet: Taqman-based qPCR assays were purchased from Applied Biosystems (ABI) and are listed as follows: APOE (Hs00171168_m1), ARR3 (Hs00182888_m1), CRX (Hs00230899_m1), CRYM (Hs00157121_m1), CST11 (Hs00370023_m1), DELGEF (Hs00183730_m1), DPP4 (Hs00175210_m1), GAPDH (Hs99999905_m1), GNB3 (Hs00157740_m1), GNGT1 (Hs00184207_m1), GNGT2 (Hs00258864_m1), GCAP1 (Hs00181172_m1), HEG1 (Hs00419997_m1), HR (Hs00218222_m1), IMPDH1 (Hs00265302_m1), LIPG (Hs00195812_m1), LMOD1 (Hs00201704_m1), OPN1LW/OPN1MW (Hs00241039_m1), PDE6C (Hs00196421_m1), PDE6H (Hs00196432_m1), PYY (Hs00373890_g1), RP1L1 (Hs00698865_m1), RRAD (Hs00188163_m1), SAG (Hs00167021_m1), SALL1 (Hs00231307_m1), TIMP3 (Hs00165949_m1). table ft1 table-wrap mode="anchored" t5 caption a7 Methods Gene Symbol Primer Sequence (5’ to 3’) Cycling Condition Gel analysis GAPDH GAPDH1F CGCTGAGTACGTCGTGGAGTC 95°C 15 s and 64°C 50s(25 cycles) GAPDH1R CACAGTCTTCTGGGTGGCAGT RXRA hRXRα-F CAT CTT TGA CAG GGT GCT GAC 95°C 15 s, 62°C 30s, 72°C 40s (35 cycles) hRXRα-R TGC TCT GGG TAC TTG TGC TTG RXRB hRXRβ-F GAG TAG GAG CCA TCT TTG ATC G hRXRβ-R TAG CAG CAG CTT GGC AAA CCG RXRG hRXRγ-F GGT CGG CTC CAT CTT TGA CAG hRXRγ-R TTG GCA AAC CTG CCT GGC TG L/M opsin CB196 TACCCCGGGGTGCAGTCTTAC 98°C 10 s and 66°C 30 s (30 cycles) CB78 TTGGCAGCAGCAAAGCATGCG SYBR-qPCR M-opsin (OPN1MW) CB7G ACCCCACTCAGCATCATCGT 95°C 15 s and 62°C 40 s (40 cycles) CB79G CCAGCAGAAGCAGAATGCCAGGAC L-opsin (OPN1LW) CB7R ATCCCACTCGCTATCATCAT CB79R CCAGCAGACGCAGTACGCAAAGATC GMPR GMPR-F1 CGTGTTCAGCTAACCCTGGGGAC 95°C 15 s and 65°C 40s (40 cycles) GMPR-R1 ACCATTCAGGAGCAGCCAGAAGC ITM2C ITM2C-F1 AAGCAAGGAGCTAGGACCCCCAG ITM2C-R1 GACTGAGCAGTGACCTTGCCTGC KIAA1755 KIAA1755-F1 TCATTGTGGAAAGACCTGTCGGC KIAA1755-R1 ACCCGAGGGGAGAGCTGTGTATG MARCO MARCO-F1 GGGACAATTTGCGATGACGAGTG MARCO-R1 CCAGCTCCCACTTTGTACAGGGC PAMLM2-AKAP2 PALM2-AKAP2-F1 TGCATTCTGCCGTGTTTATAGGTG PALM2-AKAP2-R1 TGCCACTGACAGACCCTGTTTCC RARI14 RAI14-F1 ACGCTTGCAACTTCCCTTATGGC RAI14-R1 ACTGAGGCCAAGCAGCCTTGTG SPON2 SPON2-F1 CTGCTCTCAGCCTCCTCCTCCTG SPON2-R1 CCCCTGGACGATGAAGGACAATC TFF1 TFF1-F1 TCGACGTCCCTCCAGAAGAGGAG TFF1-R1 GCAGAAGCGTGTCTGAGGTGTCC THEDC1 THEDC1-F1 GTACATTCAAAGGCCTGGCATCG THEDC1-R1 CTTCAGCAAAATGCTTGGGGGTG TP53I3 TP53I3-F1 AGGCAAGATCGTCCTGGAACTGC TP53I3-R1 TAAACGGCTCTGGAGGAAGCACC TRA@ TRA@-F1 CTCGAACCGAACAGCAGTGCTTC TRA@-R1 TCTCTCAGCTGGTACACGGCAGG TU3A TU3A-F1 TGGTGTGAGGACCATGCTGTGAG TU3A-R1 GTTGCAGAAGTGGGGTGGGAATC Open in a separate window Primers used for RT-PCR and SYBR-based qRT-PCR analyses All qPCR analyses were performed using the Applied Biosystems 7500 apparatus and analyzed by the Relative Quantification ddCt method.

Techniques: Membrane, Sequencing, Activity Assay

Journal:

Article Title: Identification of Novel Retinal Target Genes of Thyroid Hormone in the Human WERI Cells by Expression Microarray Analysis

doi: 10.1016/j.visres.2007.04.023

Figure Lengend Snippet: Validation of microarray data by qRT-PCR analysis

Article Snippet: Taqman-based qPCR assays were purchased from Applied Biosystems (ABI) and are listed as follows: APOE (Hs00171168_m1), ARR3 (Hs00182888_m1), CRX (Hs00230899_m1), CRYM (Hs00157121_m1), CST11 (Hs00370023_m1), DELGEF (Hs00183730_m1), DPP4 (Hs00175210_m1), GAPDH (Hs99999905_m1), GNB3 (Hs00157740_m1), GNGT1 (Hs00184207_m1), GNGT2 (Hs00258864_m1), GCAP1 (Hs00181172_m1), HEG1 (Hs00419997_m1), HR (Hs00218222_m1), IMPDH1 (Hs00265302_m1), LIPG (Hs00195812_m1), LMOD1 (Hs00201704_m1), OPN1LW/OPN1MW (Hs00241039_m1), PDE6C (Hs00196421_m1), PDE6H (Hs00196432_m1), PYY (Hs00373890_g1), RP1L1 (Hs00698865_m1), RRAD (Hs00188163_m1), SAG (Hs00167021_m1), SALL1 (Hs00231307_m1), TIMP3 (Hs00165949_m1). table ft1 table-wrap mode="anchored" t5 caption a7 Methods Gene Symbol Primer Sequence (5’ to 3’) Cycling Condition Gel analysis GAPDH GAPDH1F CGCTGAGTACGTCGTGGAGTC 95°C 15 s and 64°C 50s(25 cycles) GAPDH1R CACAGTCTTCTGGGTGGCAGT RXRA hRXRα-F CAT CTT TGA CAG GGT GCT GAC 95°C 15 s, 62°C 30s, 72°C 40s (35 cycles) hRXRα-R TGC TCT GGG TAC TTG TGC TTG RXRB hRXRβ-F GAG TAG GAG CCA TCT TTG ATC G hRXRβ-R TAG CAG CAG CTT GGC AAA CCG RXRG hRXRγ-F GGT CGG CTC CAT CTT TGA CAG hRXRγ-R TTG GCA AAC CTG CCT GGC TG L/M opsin CB196 TACCCCGGGGTGCAGTCTTAC 98°C 10 s and 66°C 30 s (30 cycles) CB78 TTGGCAGCAGCAAAGCATGCG SYBR-qPCR M-opsin (OPN1MW) CB7G ACCCCACTCAGCATCATCGT 95°C 15 s and 62°C 40 s (40 cycles) CB79G CCAGCAGAAGCAGAATGCCAGGAC L-opsin (OPN1LW) CB7R ATCCCACTCGCTATCATCAT CB79R CCAGCAGACGCAGTACGCAAAGATC GMPR GMPR-F1 CGTGTTCAGCTAACCCTGGGGAC 95°C 15 s and 65°C 40s (40 cycles) GMPR-R1 ACCATTCAGGAGCAGCCAGAAGC ITM2C ITM2C-F1 AAGCAAGGAGCTAGGACCCCCAG ITM2C-R1 GACTGAGCAGTGACCTTGCCTGC KIAA1755 KIAA1755-F1 TCATTGTGGAAAGACCTGTCGGC KIAA1755-R1 ACCCGAGGGGAGAGCTGTGTATG MARCO MARCO-F1 GGGACAATTTGCGATGACGAGTG MARCO-R1 CCAGCTCCCACTTTGTACAGGGC PAMLM2-AKAP2 PALM2-AKAP2-F1 TGCATTCTGCCGTGTTTATAGGTG PALM2-AKAP2-R1 TGCCACTGACAGACCCTGTTTCC RARI14 RAI14-F1 ACGCTTGCAACTTCCCTTATGGC RAI14-R1 ACTGAGGCCAAGCAGCCTTGTG SPON2 SPON2-F1 CTGCTCTCAGCCTCCTCCTCCTG SPON2-R1 CCCCTGGACGATGAAGGACAATC TFF1 TFF1-F1 TCGACGTCCCTCCAGAAGAGGAG TFF1-R1 GCAGAAGCGTGTCTGAGGTGTCC THEDC1 THEDC1-F1 GTACATTCAAAGGCCTGGCATCG THEDC1-R1 CTTCAGCAAAATGCTTGGGGGTG TP53I3 TP53I3-F1 AGGCAAGATCGTCCTGGAACTGC TP53I3-R1 TAAACGGCTCTGGAGGAAGCACC TRA@ TRA@-F1 CTCGAACCGAACAGCAGTGCTTC TRA@-R1 TCTCTCAGCTGGTACACGGCAGG TU3A TU3A-F1 TGGTGTGAGGACCATGCTGTGAG TU3A-R1 GTTGCAGAAGTGGGGTGGGAATC Open in a separate window Primers used for RT-PCR and SYBR-based qRT-PCR analyses All qPCR analyses were performed using the Applied Biosystems 7500 apparatus and analyzed by the Relative Quantification ddCt method.

Techniques: Biomarker Discovery, Microarray

Journal:

Article Title: Identification of Novel Retinal Target Genes of Thyroid Hormone in the Human WERI Cells by Expression Microarray Analysis

doi: 10.1016/j.visres.2007.04.023

Figure Lengend Snippet: RNA samples used for microarray analysis mock (Mock) and 100 nM T3 (TH), were subjected to qRT-PCR to measure the expression levels of the 37 target genes identified by microarray analysis. The data for all 37 genes can be found in Table 4. This figure shows the amplification curves of 8 genes: GAPDH (used for normalization), LMOD1 (an up-regulated non-retinal gene), 5 up-regulated retinal genes (OPN1LW/MW, CRX, RP1L1, TIMP3 and GNGT2), and 1 down-regulated retinal gene (GNGT1). Each sample contains three biological replicates and was assayed in duplicate.

Article Snippet: Taqman-based qPCR assays were purchased from Applied Biosystems (ABI) and are listed as follows: APOE (Hs00171168_m1), ARR3 (Hs00182888_m1), CRX (Hs00230899_m1), CRYM (Hs00157121_m1), CST11 (Hs00370023_m1), DELGEF (Hs00183730_m1), DPP4 (Hs00175210_m1), GAPDH (Hs99999905_m1), GNB3 (Hs00157740_m1), GNGT1 (Hs00184207_m1), GNGT2 (Hs00258864_m1), GCAP1 (Hs00181172_m1), HEG1 (Hs00419997_m1), HR (Hs00218222_m1), IMPDH1 (Hs00265302_m1), LIPG (Hs00195812_m1), LMOD1 (Hs00201704_m1), OPN1LW/OPN1MW (Hs00241039_m1), PDE6C (Hs00196421_m1), PDE6H (Hs00196432_m1), PYY (Hs00373890_g1), RP1L1 (Hs00698865_m1), RRAD (Hs00188163_m1), SAG (Hs00167021_m1), SALL1 (Hs00231307_m1), TIMP3 (Hs00165949_m1). table ft1 table-wrap mode="anchored" t5 caption a7 Methods Gene Symbol Primer Sequence (5’ to 3’) Cycling Condition Gel analysis GAPDH GAPDH1F CGCTGAGTACGTCGTGGAGTC 95°C 15 s and 64°C 50s(25 cycles) GAPDH1R CACAGTCTTCTGGGTGGCAGT RXRA hRXRα-F CAT CTT TGA CAG GGT GCT GAC 95°C 15 s, 62°C 30s, 72°C 40s (35 cycles) hRXRα-R TGC TCT GGG TAC TTG TGC TTG RXRB hRXRβ-F GAG TAG GAG CCA TCT TTG ATC G hRXRβ-R TAG CAG CAG CTT GGC AAA CCG RXRG hRXRγ-F GGT CGG CTC CAT CTT TGA CAG hRXRγ-R TTG GCA AAC CTG CCT GGC TG L/M opsin CB196 TACCCCGGGGTGCAGTCTTAC 98°C 10 s and 66°C 30 s (30 cycles) CB78 TTGGCAGCAGCAAAGCATGCG SYBR-qPCR M-opsin (OPN1MW) CB7G ACCCCACTCAGCATCATCGT 95°C 15 s and 62°C 40 s (40 cycles) CB79G CCAGCAGAAGCAGAATGCCAGGAC L-opsin (OPN1LW) CB7R ATCCCACTCGCTATCATCAT CB79R CCAGCAGACGCAGTACGCAAAGATC GMPR GMPR-F1 CGTGTTCAGCTAACCCTGGGGAC 95°C 15 s and 65°C 40s (40 cycles) GMPR-R1 ACCATTCAGGAGCAGCCAGAAGC ITM2C ITM2C-F1 AAGCAAGGAGCTAGGACCCCCAG ITM2C-R1 GACTGAGCAGTGACCTTGCCTGC KIAA1755 KIAA1755-F1 TCATTGTGGAAAGACCTGTCGGC KIAA1755-R1 ACCCGAGGGGAGAGCTGTGTATG MARCO MARCO-F1 GGGACAATTTGCGATGACGAGTG MARCO-R1 CCAGCTCCCACTTTGTACAGGGC PAMLM2-AKAP2 PALM2-AKAP2-F1 TGCATTCTGCCGTGTTTATAGGTG PALM2-AKAP2-R1 TGCCACTGACAGACCCTGTTTCC RARI14 RAI14-F1 ACGCTTGCAACTTCCCTTATGGC RAI14-R1 ACTGAGGCCAAGCAGCCTTGTG SPON2 SPON2-F1 CTGCTCTCAGCCTCCTCCTCCTG SPON2-R1 CCCCTGGACGATGAAGGACAATC TFF1 TFF1-F1 TCGACGTCCCTCCAGAAGAGGAG TFF1-R1 GCAGAAGCGTGTCTGAGGTGTCC THEDC1 THEDC1-F1 GTACATTCAAAGGCCTGGCATCG THEDC1-R1 CTTCAGCAAAATGCTTGGGGGTG TP53I3 TP53I3-F1 AGGCAAGATCGTCCTGGAACTGC TP53I3-R1 TAAACGGCTCTGGAGGAAGCACC TRA@ TRA@-F1 CTCGAACCGAACAGCAGTGCTTC TRA@-R1 TCTCTCAGCTGGTACACGGCAGG TU3A TU3A-F1 TGGTGTGAGGACCATGCTGTGAG TU3A-R1 GTTGCAGAAGTGGGGTGGGAATC Open in a separate window Primers used for RT-PCR and SYBR-based qRT-PCR analyses All qPCR analyses were performed using the Applied Biosystems 7500 apparatus and analyzed by the Relative Quantification ddCt method.

Techniques: Microarray, Quantitative RT-PCR, Expressing, Amplification

Journal: Diagnostic Pathology

Article Title: Promoter methylation and expression of TIMP3 gene in gastric cancer

doi: 10.1186/1746-1596-8-110

Figure Lengend Snippet: Gastric carcinoma TIMP3 promoter methylation and protein expression

Article Snippet: TIMP3 antibody and SP kit were purchased from Boster Biological Engineering Co., Ltd. (Dalian).

Techniques: Methylation, Expressing

Journal: Diagnostic Pathology

Article Title: Promoter methylation and expression of TIMP3 gene in gastric cancer

doi: 10.1186/1746-1596-8-110

Figure Lengend Snippet: TIMP3 protein immunohistochemisty (SP 400×): a, normal gastric tissue; b, early gastric cancer; c, advanced gastric cancer; d, transfer of lymph node.

Article Snippet: TIMP3 antibody and SP kit were purchased from Boster Biological Engineering Co., Ltd. (Dalian).

Techniques:

Journal: Diagnostic Pathology

Article Title: Promoter methylation and expression of TIMP3 gene in gastric cancer

doi: 10.1186/1746-1596-8-110

Figure Lengend Snippet: Relationship between advanced gastric cancer pathology TIMP3 methylation and its protein expression level

Article Snippet: TIMP3 antibody and SP kit were purchased from Boster Biological Engineering Co., Ltd. (Dalian).

Techniques: Methylation, Expressing

Journal: BMC cancer

Article Title: CLEC19A overexpression inhibits tumor cell proliferation/migration and promotes apoptosis concomitant suppression of PI3K/AKT/NF-κB signaling pathway in glioblastoma multiforme.

doi: 10.1186/s12885-023-11755-9

Figure Lengend Snippet: Fig. 4 Effects of CLEC19A overexpression on cell migration. A, B In vitro wound healing analysis of U87 stable cells transfected with pCL19A and mock vectors at 0 h, 24 h, 48 h, 96, and 120 h post-scratching. CLEC19A overexpression in U87 cells significantly decreased cell migration in all time points tested. C, D wound healing assay of C6 stable cells following transfection with pCL19A and mock vectors at 0 h, 24 h, 48 h and 72 h. The overexpression of CLEC19A could decline the cell migration rate in C6 cells. E, F Transwell migration assay was administrated 24 h after seeded U87 stable cells on chambers. The number of migrated cells was significantly decreased in the U87 cell line after 24 h. G, H Show transwell migration assay in C6 stable cells after 24 h post-seeding. The migrated cell counts indicate that migration ability was significantly reduced in C6 cells transfected with pCL19A compared to mock cells. I, J VEGFα, RECK, TIMP3, and MMP2 mRNA levels in U87 and C6 cells. The qRT-PCR results suggest that overexpression of CLEC19A significantly decreases the migration potential of glioma cancer cells. K Western blot analysis of TIMP3, RECK, and MMP2 protein levels in U87 stable cells transfected by pCL19A and mock vector. β-Actin was used as endogenous control. A decrease in the MMP2 protein level and an increase in the TIPM3 and RECK protein levels indicated that overexpression of CLEC19A reduced the ability of U87 cancer cell migration. Columns and points, mean of three different experiments. Statistical analysis was conducted using a one-way ANOVA or student t-test and means ± SEM were shown. ns = not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001

Article Snippet: Subsequently, the membrane was incubated with the primary antibodies to GFP (Santa Cruz, USA, sc-9996, 1:300), MMP2 (Santa Cruz, USA, sc-10736, 1:300), RECK (Santa Cruz, USA, sc-373929, 1:300), BAX (Santa Cruz, USA, sc-7480, 1:300), BCL2 (Santa Cruz, USA, sc-492, 1:300), IκB-α (Santa Cruz, USA, sc-1643, 1:300), TIMP3 (Santa Cruz, USA, sc-373839, 1:300), PI3K (Santa Cruz, USA, sc-67306, 1:300), and β-Actin (Santa Cruz, USA, sc-47778, 1:300) overnight at 4 °C.

Techniques: Over Expression, Migration, In Vitro, Transfection, Wound Healing Assay, Transwell Migration Assay, Quantitative RT-PCR, Western Blot, Plasmid Preparation, Control

Journal: BMC cancer

Article Title: CLEC19A overexpression inhibits tumor cell proliferation/migration and promotes apoptosis concomitant suppression of PI3K/AKT/NF-κB signaling pathway in glioblastoma multiforme.

doi: 10.1186/s12885-023-11755-9

Figure Lengend Snippet: Fig. 7 Schematic representation of different pathways regulation by CLEC19A overexpression. The overexpression of CLEC19A, targeting the PI3k, PTEN, AKT, NF-κB, and PDCD4 transcripts results in reduced PI3K/AKT/NF-κB signaling pathway activity which affects the biological process of cells, including cell proliferation and viability. Moreover, CLEC19A regulates cell migration in this model by targeting VEGFα, RECK, TIMP3, and MMP2. CLEC19A overexpression can reduce cell migration in glioma cells. As shown in this Figure, overexpression of CLEC19A can promote apoptosis by targeting BCL2L11, BAX, and BCL, and also arrest the cell cycle by reduction of CCNA2 expression and up-regulation of CDKN1A (Parts of the figure are drawn by the BioRender site)

Article Snippet: Subsequently, the membrane was incubated with the primary antibodies to GFP (Santa Cruz, USA, sc-9996, 1:300), MMP2 (Santa Cruz, USA, sc-10736, 1:300), RECK (Santa Cruz, USA, sc-373929, 1:300), BAX (Santa Cruz, USA, sc-7480, 1:300), BCL2 (Santa Cruz, USA, sc-492, 1:300), IκB-α (Santa Cruz, USA, sc-1643, 1:300), TIMP3 (Santa Cruz, USA, sc-373839, 1:300), PI3K (Santa Cruz, USA, sc-67306, 1:300), and β-Actin (Santa Cruz, USA, sc-47778, 1:300) overnight at 4 °C.

Techniques: Over Expression, Activity Assay, Migration, Expressing

Journal: World Journal of Gastroenterology : WJG

Article Title: miRNA studies in in vitro and in vivo activated hepatic stellate cells

doi: 10.3748/wjg.v17.i22.

Figure Lengend Snippet: Upregulated genes in miR-146a-transfected hepatic stellate cell-2

Article Snippet: Taqman assays used were smooth muscle α-actin (SMAA) (Rn01759928_g1), Col1a1 (Rn01463849_g1), interleukin (IL)-6 (Rn00561420_m1), cyclooxygenase-2 (Cox-2) (Rn00568225_m1), RelA (Rn01502266_m1), CD31 (Rn01467259_m1), Albumin (Rn01413833_m1), CD68 (Rn01495643_g1) and tissue inhibitor of metalloproteinase (TIMP)-3 (Rn00441826_m1).

Techniques: Membrane, Translocation Assay, Coagulation, Sequencing, Binding Assay, Clinical Proteomics, Protein Binding, Activity Assay, RNA Binding Assay, Starch

Journal: Human Reproduction (Oxford, England)

Article Title: Chronic hyperandrogenemia in the presence and absence of a western-style diet impairs ovarian and uterine structure/function in young adult rhesus monkeys

doi: 10.1093/humrep/dex338

Figure Lengend Snippet: Photomicrographs illustrating immunohistochemical staining for estrogen receptor 1 (ESR1), progesterone receptor (PGR) MMP26, TIMP3, Ki-67 and androgen receptor (AR) in the endometrial functionalis zone of the macaque uterus from representative females in each treatment group (C, T, WSD, T+WSD). Brown staining denotes positive expression of proteins. Sections are counterstained with hematoxylin (blue) staining. ESR1, PGR, Ki-67 and AR staining is nuclear, while MMP26 and TIMP3 show cytoplasmic localization. Inset shows a negative control with an irrelevant antibody (Anti-Br(d)U). TIMP3 staining was localized to the predecidual cells around the spiral arteries.

Article Snippet: Antibodies used were against estrogen receptor 1 (ESR1,ER-ID5; Cat#: MS-354-P, Thermo Fisher Scientific), progesterone receptor (PGR, Cat#: Ms-298-P, 1 μg, Lab Vision/NeoMarkers, Fremont, CA, USA), androgen receptor (AR-F39 (Cat#: MU256, 1/50, BioGenex, Fremont, CA, USA), Ki67 (Cat#: MU370-UC, 1/200, BioGenex), MMP26 (Cat# ab57636; Abcam, Cambridge, MA, USA) and TIMP3 (Cat#:MAB973, R&D Systems, Inc. Minneapolis, MN, USA).

Techniques: Immunohistochemical staining, Staining, Expressing, Negative Control

Journal: Human Reproduction (Oxford, England)

Article Title: Chronic hyperandrogenemia in the presence and absence of a western-style diet impairs ovarian and uterine structure/function in young adult rhesus monkeys

doi: 10.1093/humrep/dex338

Figure Lengend Snippet: Expression of ESR1, PGR, MMP26 and TIMP3 mRNAs as detected by qRT-PCR in endometrial biopsies collected from macaques in the mid-luteal phase of the cycle. Significant (P < 0.05) differences between individual treatment groups are denoted by different uppercase letters above columns.

Article Snippet: Antibodies used were against estrogen receptor 1 (ESR1,ER-ID5; Cat#: MS-354-P, Thermo Fisher Scientific), progesterone receptor (PGR, Cat#: Ms-298-P, 1 μg, Lab Vision/NeoMarkers, Fremont, CA, USA), androgen receptor (AR-F39 (Cat#: MU256, 1/50, BioGenex, Fremont, CA, USA), Ki67 (Cat#: MU370-UC, 1/200, BioGenex), MMP26 (Cat# ab57636; Abcam, Cambridge, MA, USA) and TIMP3 (Cat#:MAB973, R&D Systems, Inc. Minneapolis, MN, USA).

Techniques: Expressing, Quantitative RT-PCR